Review





Similar Products

94
Toyobo tak101 vector
Tak101 Vector, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tak101 vector/product/Toyobo
Average 94 stars, based on 1 article reviews
tak101 vector - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

96
Vector Laboratories nsd2 targeting
Nsd2 Targeting, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nsd2 targeting/product/Vector Laboratories
Average 96 stars, based on 1 article reviews
nsd2 targeting - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

90
Obio Technology Corp Ltd aav vectors harboring the hsyn-specific promoter and encoding shrna1 targeting brd4
Aav Vectors Harboring The Hsyn Specific Promoter And Encoding Shrna1 Targeting Brd4, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav vectors harboring the hsyn-specific promoter and encoding shrna1 targeting brd4/product/Obio Technology Corp Ltd
Average 90 stars, based on 1 article reviews
aav vectors harboring the hsyn-specific promoter and encoding shrna1 targeting brd4 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Toyobo vector pta2
Vector Pta2, supplied by Toyobo, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/vector pta2/product/Toyobo
Average 94 stars, based on 1 article reviews
vector pta2 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

98
Vector Laboratories a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size
A11055 Ab 2534102 Nuclear Staining Dapi Na Vector Laboratories H 1200 Ab 2336790 Primers Target Size, supplied by Vector Laboratories, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size/product/Vector Laboratories
Average 98 stars, based on 1 article reviews
a11055 ab 2534102 nuclear staining dapi na vector laboratories h 1200 ab 2336790 primers target size - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

97
New England Biolabs targeting vector
Targeting Vector, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/targeting vector/product/New England Biolabs
Average 97 stars, based on 1 article reviews
targeting vector - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

90
VectorBuilder GmbH lentiviral vectors containing shrnas targeting dnmt1
High expression of <t>DNMT1</t> promotes DNA methylation of the SOX21 promoter. A Prediction of CpG islands in the SOX21 promoter region using the MethPrimer database. B The methylation of the SOX21 promoter region was predicted on the Mexpress database. C The correlation between DNMT3A, DNMT1, DNMT3B, DNMT3L, and SOX21 methylation levels in GC from the Meth450 platform in the LinkOmics database using Spearman analysis. D DNMT1 expression was predicted in the STAD-UALCAN database. E The protein expression of DNMT1 in adjacent and tumor tissues in GC patients was examined using western blot analysis ( n = 13). F The protein expression of DNMT1 in GC cells and GES-1 cells was examined using western blot analysis. G The mRNA expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using RT-qPCR. H The protein expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using western blot analysis. I The methylation level of the SOX21 promoter in GC cells infected with sh-NC or sh-DNMT1 #2 was examined using the MSP assay. J The binding relation between DNMT1 and the SOX21 promoter was verified using a ChIP assay. K The binding relation between DNMT1 and the SOX21 promoter was examined using luciferase assays. L The mRNA expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using RT-qPCR. M The protein expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using western blot analysis. Paired or unpaired t-tests were used to compare the data between two groups, and ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means of three independent experiments
Lentiviral Vectors Containing Shrnas Targeting Dnmt1, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lentiviral vectors containing shrnas targeting dnmt1/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
lentiviral vectors containing shrnas targeting dnmt1 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH aav vectors expressing shrna targeting chrebp
a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
Aav Vectors Expressing Shrna Targeting Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav vectors expressing shrna targeting chrebp/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
aav vectors expressing shrna targeting chrebp - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
VectorBuilder GmbH aav vectors expressing shrna that targets chrebp
a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated <t>viruses</t> <t>(AAV)</t> -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.
Aav Vectors Expressing Shrna That Targets Chrebp, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/aav vectors expressing shrna that targets chrebp/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
aav vectors expressing shrna that targets chrebp - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


High expression of DNMT1 promotes DNA methylation of the SOX21 promoter. A Prediction of CpG islands in the SOX21 promoter region using the MethPrimer database. B The methylation of the SOX21 promoter region was predicted on the Mexpress database. C The correlation between DNMT3A, DNMT1, DNMT3B, DNMT3L, and SOX21 methylation levels in GC from the Meth450 platform in the LinkOmics database using Spearman analysis. D DNMT1 expression was predicted in the STAD-UALCAN database. E The protein expression of DNMT1 in adjacent and tumor tissues in GC patients was examined using western blot analysis ( n = 13). F The protein expression of DNMT1 in GC cells and GES-1 cells was examined using western blot analysis. G The mRNA expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using RT-qPCR. H The protein expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using western blot analysis. I The methylation level of the SOX21 promoter in GC cells infected with sh-NC or sh-DNMT1 #2 was examined using the MSP assay. J The binding relation between DNMT1 and the SOX21 promoter was verified using a ChIP assay. K The binding relation between DNMT1 and the SOX21 promoter was examined using luciferase assays. L The mRNA expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using RT-qPCR. M The protein expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using western blot analysis. Paired or unpaired t-tests were used to compare the data between two groups, and ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means of three independent experiments

Journal: BMC Cancer

Article Title: DNMT1 blocks SOX21-repressed CKS2 transcription to promote gastric cancer progression

doi: 10.1186/s12885-025-14577-z

Figure Lengend Snippet: High expression of DNMT1 promotes DNA methylation of the SOX21 promoter. A Prediction of CpG islands in the SOX21 promoter region using the MethPrimer database. B The methylation of the SOX21 promoter region was predicted on the Mexpress database. C The correlation between DNMT3A, DNMT1, DNMT3B, DNMT3L, and SOX21 methylation levels in GC from the Meth450 platform in the LinkOmics database using Spearman analysis. D DNMT1 expression was predicted in the STAD-UALCAN database. E The protein expression of DNMT1 in adjacent and tumor tissues in GC patients was examined using western blot analysis ( n = 13). F The protein expression of DNMT1 in GC cells and GES-1 cells was examined using western blot analysis. G The mRNA expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using RT-qPCR. H The protein expression of DNMT1 in GC cells infected with shRNAs targeting DNMT1 was examined using western blot analysis. I The methylation level of the SOX21 promoter in GC cells infected with sh-NC or sh-DNMT1 #2 was examined using the MSP assay. J The binding relation between DNMT1 and the SOX21 promoter was verified using a ChIP assay. K The binding relation between DNMT1 and the SOX21 promoter was examined using luciferase assays. L The mRNA expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using RT-qPCR. M The protein expression of SOX21 in GC cells infected with sh-DNMT1 #2 was examined using western blot analysis. Paired or unpaired t-tests were used to compare the data between two groups, and ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means of three independent experiments

Article Snippet: Lentiviral vectors containing shRNAs targeting DNMT1 or SOX21 (Table ), overexpression of SOX21, and overexpression of CKS2 (all from VectorBuilder, Guangzhou, Guangdong, China) were used to infect AGS and NCI-N87 cells, and Polybrene was added (1 μL/mL, C0351-1 ml, Beyotime, Shanghai, China).

Techniques: Expressing, DNA Methylation Assay, Methylation, Western Blot, Infection, Quantitative RT-PCR, MSP Assay, Binding Assay, Luciferase

Silencing of SOX21 abates the anti-proliferative and pro-apoptotic properties of sh-DNMT1 on GC cells. A The mRNA expression of SOX21 in GC cells infected with sh-DNMT1 + shRNAs targeting SOX21 was examined using RT-qPCR. B The protein expression of SOX21 in GC cells infected with sh-DNMT1 + shRNAs targeting SOX21 was examined using western blot analysis. C The EdU-positive GC cells after infection. D The OD value of GC cells was read at 0, 24, 48, and 72 h using the CCK-8 assay. E The migration and invasion of GC cells were examined using the Transwell assay. F Detection of apoptosis in GC cells by TUNEL assay. ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means of three independent experiments

Journal: BMC Cancer

Article Title: DNMT1 blocks SOX21-repressed CKS2 transcription to promote gastric cancer progression

doi: 10.1186/s12885-025-14577-z

Figure Lengend Snippet: Silencing of SOX21 abates the anti-proliferative and pro-apoptotic properties of sh-DNMT1 on GC cells. A The mRNA expression of SOX21 in GC cells infected with sh-DNMT1 + shRNAs targeting SOX21 was examined using RT-qPCR. B The protein expression of SOX21 in GC cells infected with sh-DNMT1 + shRNAs targeting SOX21 was examined using western blot analysis. C The EdU-positive GC cells after infection. D The OD value of GC cells was read at 0, 24, 48, and 72 h using the CCK-8 assay. E The migration and invasion of GC cells were examined using the Transwell assay. F Detection of apoptosis in GC cells by TUNEL assay. ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means of three independent experiments

Article Snippet: Lentiviral vectors containing shRNAs targeting DNMT1 or SOX21 (Table ), overexpression of SOX21, and overexpression of CKS2 (all from VectorBuilder, Guangzhou, Guangdong, China) were used to infect AGS and NCI-N87 cells, and Polybrene was added (1 μL/mL, C0351-1 ml, Beyotime, Shanghai, China).

Techniques: Expressing, Infection, Quantitative RT-PCR, Western Blot, CCK-8 Assay, Migration, Transwell Assay, TUNEL Assay

DNMT1/SOX21/CKS2 axis is involved in GC progression in vivo. A The representative images of subcutaneous xenograft tumors in nude mice and the tumor growth curve within 25 d. B The weight of tumors formed by AGS cells with sh-NC, sh-DNMT1 #2 + sh-NC, sh-DNMT1 #2 + sh-SOX21 #3, oe-SOX21 + oe-NC, or oe-SOX21 + oe-CKS2 at day 25. C DNMT1, SOX21, and CKS2 expression in the tumor tissues was examined using western blot analysis. D The representative immunohistochemical images and positive cells of Ki67 and cleaved-caspase-3 in the tumor tissues formed by AGS cells. ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means ( n = 6)

Journal: BMC Cancer

Article Title: DNMT1 blocks SOX21-repressed CKS2 transcription to promote gastric cancer progression

doi: 10.1186/s12885-025-14577-z

Figure Lengend Snippet: DNMT1/SOX21/CKS2 axis is involved in GC progression in vivo. A The representative images of subcutaneous xenograft tumors in nude mice and the tumor growth curve within 25 d. B The weight of tumors formed by AGS cells with sh-NC, sh-DNMT1 #2 + sh-NC, sh-DNMT1 #2 + sh-SOX21 #3, oe-SOX21 + oe-NC, or oe-SOX21 + oe-CKS2 at day 25. C DNMT1, SOX21, and CKS2 expression in the tumor tissues was examined using western blot analysis. D The representative immunohistochemical images and positive cells of Ki67 and cleaved-caspase-3 in the tumor tissues formed by AGS cells. ANOVA and Tukey’s post hoc test were used to compare the data between multiple groups. Data are expressed as means ± standard errors of the means ( n = 6)

Article Snippet: Lentiviral vectors containing shRNAs targeting DNMT1 or SOX21 (Table ), overexpression of SOX21, and overexpression of CKS2 (all from VectorBuilder, Guangzhou, Guangdong, China) were used to infect AGS and NCI-N87 cells, and Polybrene was added (1 μL/mL, C0351-1 ml, Beyotime, Shanghai, China).

Techniques: In Vivo, Expressing, Western Blot, Immunohistochemical staining

a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Journal: Nature Communications

Article Title: Sex difference in BAT thermogenesis depends on PGC-1α–mediated phospholipid synthesis in mice

doi: 10.1038/s41467-025-61219-w

Figure Lengend Snippet: a Gene expression of Chrebpβ and DNL-related genes in female BAT injected with adeno-associated viruses (AAV) -shScramble or AAV-shChrebp. n = 6 per group. p = 0.0014 for Chrebpβ , p = 0.0001 for Acly , p = 0.0013 for Acss2 , p < 0.0001 for Fasn , p = 0.0005 for Acaca , and p = 0.1527 for Elovl6 . b Gene expression of Pgc1a . n = 6 per group. p = 0.0474. c Oxygen consumption (VO 2 ) recordings in response to NE. n = 7 per group. p = 0.0122. d Representative electron micrographs of mitochondria from BAT of AAV-Scramble and AAV-shChrebp mice. Scale bar = 1 μm ( n = 3 biologically independent experiments). e Total cristae length per mitochondrion. n = 30 per group. p = 0.0271. f Percentage of CL(18:2) 4 in total CL. n = 5 per group. g Percentage of ether-linked PEs in total lipids. n = 5 per group. p = 0.0236, 0.0358, and 0.0395 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. h D₂O-labeled components of ether-linked PEs. n = 3 per group. p = 0.3849, 0.0376, and 0.9923 for PE-O(16:1/16:1), PE-O(16:1/18:1), and PE-O(18:1/16:0), respectively. Data are expressed as the mea n ± SEM. Data were analyzed using unpaired two-sided t-tests ( a , b , e ), paired one-sided t-tests ( f – h ), and two-way repeated measures ANOVA ( c ). Significance is indicated (* p < 0.05; ** p < 0.01; *** p < 0.001; **** p < 0.0001). Source data are provided as a file.

Article Snippet: AAV vectors expressing shRNA that targets Chrebp (Mlxipl, target sequence: GGACTGCTTCTTGTCCGATAT) and scrambled shRNA were obtained from VectorBuilder VB230122-1164ver and VB010000-0023jze, respectively.

Techniques: Gene Expression, Injection, Labeling